BBa_K208010 1 BBa_K208010 Lac Promoter (BBa_R0010) and RBS (B0034) 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z synthetic Released HQ 2013 lac + rbs false false _310_ 0 3473 9 In stock true none false Elisabeth Linton annotation2034625 1 BBa_B0034 range2034625 1 209 220 annotation2034626 1 BBa_R0010 range2034626 1 1 200 BBa_M45762 1 BBa_M45762 K208010:M45712 Hd1a toxin with Lac promoter and ribosome binding site. 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z false false _9_ 0 23452 9 Not in stock false false Michelle Bonebrake component2431536 1 BBa_M45712 component2431533 1 BBa_K208010 annotation2431536 1 BBa_M45712 range2431536 1 227 334 annotation2431533 1 BBa_K208010 range2431533 1 1 220 BBa_M45712 1 BBa_M45712 Hd1a toxin from Haplopelma doriae spider with start codon 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z This sequence comes from the Haplopelma doriae spider. http://onlinelibrary.wiley.com/doi/10.1111/bph.13081/full Hd1a shows signs of being possibly used as another analgesic. It effectively blocks the Nav1.7 sodium channel and thus is an effective pain blocker. false false _1855_ 0 23855 9 Not in stock false The ATG start codon was added to the beginning of the sequence. false Nicholas D. Lauritzen annotation2431528 1 Start Codon range2431528 1 1 3 annotation2431529 1 Hd1a range2431529 1 4 108 BBa_M45762_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg BBa_M45712_sequence 1 atggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg BBa_K208010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z