BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_M45790 1 BBa_M45790 M45712:B0015 2015-04-19T11:00:00Z 2015-05-08T01:14:09Z false false _9_ 0 25692 9 Not in stock false false Austin Heywood component2431701 1 BBa_B0015 component2431694 1 BBa_M45712 annotation2431701 1 BBa_B0015 range2431701 1 117 245 annotation2431694 1 BBa_M45712 range2431694 1 1 108 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_M45712 1 BBa_M45712 Hd1a toxin from Haplopelma doriae spider with start codon 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z This sequence comes from the Haplopelma doriae spider. http://onlinelibrary.wiley.com/doi/10.1111/bph.13081/full Hd1a shows signs of being possibly used as another analgesic. It effectively blocks the Nav1.7 sodium channel and thus is an effective pain blocker. false false _1855_ 0 23855 9 Not in stock false The ATG start codon was added to the beginning of the sequence. false Nicholas D. Lauritzen annotation2431529 1 Hd1a range2431529 1 4 108 annotation2431528 1 Start Codon range2431528 1 1 3 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_M45712_sequence 1 atggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg BBa_M45790_sequence 1 atggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z