BBa_M45802 1 BBa_M45802 Mutated Tuc2009 bidirectional promoter for decreased CI sensitivity 2015-04-14T11:00:00Z 2015-05-08T01:14:09Z Kenny JG, Leach S, Hoz AB, Venema G, Kok J, Fitzgerald GF, Nauta S, Alonso JC, Sinderen D (2006) Characterization of the lytic-lysogenic switch of the lactococcal bacteriophage Tuc2009. Virology 347:434-446 A modified bi-directional promoter from lactococcal bacteriophage Tuc2009 containing a bp mutation for decreased binding affinity of the CI repressor protein to the operator OL-CI at high CI concentrations. Allowing for continued up-regulated transcription from the leftward promoter (PL). See BBa_M45801 for detailed description of bi-directional promoter and intergenic switch region regulation with CI and Cro repressor proteins. false false _1855_ 0 25667 9 Not in stock false G to T change at bp 32 from BBa_M45801 on Fwd strand false Thomas Overbeck annotation2431039 1 PR range2431039 1 64 92 annotation2431043 1 OR-CI range2431043 1 65 92 annotation2431037 1 G to T range2431037 1 32 32 annotation2431040 1 OL-CRO range2431040 1 5 33 annotation2431038 1 PL range2431038 1 7 36 annotation2431041 1 OR-CRO range2431041 1 40 78 annotation2431042 1 OL-CI range2431042 1 17 44 BBa_M45802_sequence 1 aaacacattatataagaaaaaaccacgtttttcaaactttttttgtcaaatgacgtttttttcttgacaaaccacgaaaagtggactataattaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z