BBa_M45803 1 BBa_M45803 Tuc2009 Cro2009 gene (cro) Protein Repressor 2015-04-16T11:00:00Z 2015-05-08T01:14:10Z It comes from a genomic sequence found here: Kenny, J. G., Leach, S., Ana, B., Venema, G., Kok, J., Fitzgerald, G. F., ... & van Sinderen, D. (2006). Characterization of the lytic???lysogenic switch of the lactococcal bacteriophage Tuc2009. Virology, 347(2), 434-446. This is the cro repressor protein for the Tuc2009 lysogenic bacteriophage. false false _1855_ 0 25690 9 Not in stock false We needed to make sure that the restriction enzymes to be used were not present. false Carson Sparks annotation2431104 1 Stop Codon range2431104 1 229 231 annotation2431095 1 Start Codon range2431095 1 1 3 annotation2431105 1 Coding Sequence range2431105 1 4 228 BBa_M45803_sequence 1 atggcagtagaaaaagagttaattgctctgcgagcagacgaaaaaatatctcgaaaagaaatggcagaacttattgggacaacaccagaaacttatcgaaaaaaagaactcggagaaagtgattggtggggggcagaaatgttcttgattgcttccaagttcaataaacgaattgatgatatttttttagacaaaaagtccactaaaagtggtttagagaaagctagttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z