BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_M45802 1 BBa_M45802 Mutated Tuc2009 bidirectional promoter for decreased CI sensitivity 2015-04-14T11:00:00Z 2015-05-08T01:14:09Z Kenny JG, Leach S, Hoz AB, Venema G, Kok J, Fitzgerald GF, Nauta S, Alonso JC, Sinderen D (2006) Characterization of the lytic-lysogenic switch of the lactococcal bacteriophage Tuc2009. Virology 347:434-446 A modified bi-directional promoter from lactococcal bacteriophage Tuc2009 containing a bp mutation for decreased binding affinity of the CI repressor protein to the operator OL-CI at high CI concentrations. Allowing for continued up-regulated transcription from the leftward promoter (PL). See BBa_M45801 for detailed description of bi-directional promoter and intergenic switch region regulation with CI and Cro repressor proteins. false false _1855_ 0 25667 9 Not in stock false G to T change at bp 32 from BBa_M45801 on Fwd strand false Thomas Overbeck annotation2431043 1 OR-CI range2431043 1 65 92 annotation2431040 1 OL-CRO range2431040 1 5 33 annotation2431038 1 PL range2431038 1 7 36 annotation2431041 1 OR-CRO range2431041 1 40 78 annotation2431042 1 OL-CI range2431042 1 17 44 annotation2431037 1 G to T range2431037 1 32 32 annotation2431039 1 PR range2431039 1 64 92 BBa_M45805 1 BBa_M45805 Promoter 2015-04-16T11:00:00Z 2015-05-08T01:14:10Z Originates from B. subtilis A transcription factor gene that activates P(pspollE) false false _1855_ 0 25679 9 Not in stock false This sequence has been codon optimized for Lactococcus lactis false Kaitlyn C. Anderson annotation2431106 1 Start Codon range2431106 1 1 3 annotation2431107 1 Stop Codon range2431107 1 378 381 annotation2431108 1 Coding Sequence range2431108 1 4 377 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_M45810 1 BBa_M45810 Promoter sequence 2015-04-19T11:00:00Z 2015-05-08T01:14:10Z Tuc2009 and B. subtilis Rightward promoter sequence using Tuc2009 false false _1855_ 0 25679 9 Not in stock false Optimized for L. lactis false Kaitlyn C. Anderson component2431271 1 BBa_M45805 component2431264 1 BBa_M45802 component2431266 1 BBa_B0030 component2431276 1 BBa_B1006 annotation2431271 1 BBa_M45805 range2431271 1 127 507 annotation2431264 1 BBa_M45802 range2431264 1 1 97 annotation2431276 1 BBa_B1006 range2431276 1 516 554 annotation2431266 1 BBa_B0030 range2431266 1 106 120 BBa_M45805_sequence 1 atgagcagccagcctgaaccaaagaagaaaaatctcgacgcgagcatcacaagcattatccatgaaatcggcgtcccagcccatattaaaggctatctctatctgcgcgaagcaatctcaatggtatacaatgacatcgaattgctcggcagcattacaaaagtcctctatccggacatcgccaaaaaatttaacacaaccgcaagccgtgtagaaagagcgatccgccatgcaattgaagtggcatggagcagaggaaacattgattccatttcctcgttgtttggttatactgtcagcatgacaaaagctaaacctaccaacagtgaatttattgcaatggttgcggataagctgaggttagagcataaggcttcttaa BBa_M45810_sequence 1 aaacacattatataagaaaaaaccacgtttttcaaactttttttgtcaaatgacgtttttttcttgacaaaccacgaaaagtggactataattaacttactagagattaaagaggagaaatactagatgagcagccagcctgaaccaaagaagaaaaatctcgacgcgagcatcacaagcattatccatgaaatcggcgtcccagcccatattaaaggctatctctatctgcgcgaagcaatctcaatggtatacaatgacatcgaattgctcggcagcattacaaaagtcctctatccggacatcgccaaaaaatttaacacaaccgcaagccgtgtagaaagagcgatccgccatgcaattgaagtggcatggagcagaggaaacattgattccatttcctcgttgtttggttatactgtcagcatgacaaaagctaaacctaccaacagtgaatttattgcaatggttgcggataagctgaggttagagcataaggcttcttaatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_B0030_sequence 1 attaaagaggagaaa BBa_M45802_sequence 1 aaacacattatataagaaaaaaccacgtttttcaaactttttttgtcaaatgacgtttttttcttgacaaaccacgaaaagtggactataattaact BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z