BBa_M45904 1 BBa_M45904 SNAP-25 BoNT A cleavage site 2015-03-31T11:00:00Z 2015-05-08T01:14:10Z Homo sapiens genome The section of the human neurotransmitter protein SNAP-25 required for binding and cleavage by the botulinum neurotoxin A (BoNT), according to the findings of Vaidyanathan et al. (2002). false false _1855_ 0 25694 9 Not in stock false The sequence is optimized for expression in E. coli. false Aaron Fronk annotation2430850 1 Point mutation to make it RFC compatible range2430850 1 12 12 annotation2430847 1 End of sequence range2430847 1 171 171 annotation2430849 1 Start codon range2430849 1 1 3 BBa_M45904_sequence 1 atggacgagaacctagaacaagtaagcgggatcattggcaatctgcgccatatggcactagatatgggtaacgagattgacactcagaaccgccaaattgatcgaataatggaaaaagcagattccaacaaaacgcgtattgacgaagcgaatcagcgcgctacaaagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z