BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I721001 1 BBa_I721001 Lead Promoter 2007-10-25T11:00:00Z 2015-08-31T04:07:53Z ralstonia metallidurans Lead Promoter (Part 4) messed up EcoRI site false false _113_ 0 1531 58 It's complicated true none true Jeffrey Hofmann BBa_M45996 1 BBa_M45996 composite example 2014-03-24T12:00:00Z 2015-05-08T01:14:10Z dsafdsa asdfa false false _1855_ 0 2425 303 Not in stock false asdfds false Charles Miller component2371883 1 BBa_I721001 component2371885 1 BBa_B0034 annotation2371883 1 BBa_I721001 range2371883 1 1 94 annotation2371885 1 BBa_B0034 range2371885 1 103 114 BBa_I721001_sequence 1 ggttgcttcctataaaaaacttgactctatatctactagaggttttctaatgatggcatccggggaaaaccttgtcaatgaagagcgatctatg BBa_B0034_sequence 1 aaagaggagaaa BBa_M45996_sequence 1 ggttgcttcctataaaaaacttgactctatatctactagaggttttctaatgatggcatccggggaaaaccttgtcaatgaagagcgatctatgtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z