BBa_M50005 1 BBa_M50005 alkG 2016-10-26T11:00:00Z 2016-12-10T11:04:33Z alkG comes from the genome of Alcanivorax Borkumensis. alkG plays a role in the chemical transformation of alkanes to make oils easier for marine bacteria, like A. Borkumensis to digest. This gene, in combination with other genes like alkB1 in A. Borkumensis's genome, break down any alkanes with up to 32 carbons into molecules with carboxyl groups, which these bacteria are able to digest. false false _848_ 34388 34395 9 false We changed the repeat sequences in the DNA of this gene and plan to optimize this gene for expression in E. Coli. false Addie Petersen annotation2531663 1 Mutation 2: A to G range2531663 1 294 294 annotation2531662 1 Mutation 1: G to T range2531662 1 207 207 BBa_M50005_sequence 1 atggctaaatatcaatgccccgattgcgaatatatatacgatgaagtcgctggccacccacacgaaggcttccccccaggaacgtcttgggaaacgattcctgaagagtgggcctgcccagactgtgcagtaagggataaagctgacttcgtagtaatagaatccggttccgcgtccccggcgtctggcgcggccaccccagaagttcgcactgctaccaccccacctaaggcagaggcttcacctcaaaaatcaacgggggcctcgactccttcagctaacaataaagccaaggcaaaggctaaagccaaacccgcacgggcaaaatcgtctaaagactccaccggcaaagagaccacctttcgtaaatggatctgtatcacttgcggtcacatttatgatgaagctcttggcgatgaaactgaagggttcgcgccaggcactctttttgaagatatcccggacgattggtgctgtcccgactgtggtgccacaaaagaggactatgtcctccatgaagattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z