BBa_M50007 1 BBa_M50007 U1 Thermosensitive 5'-UTR (includes RBS) 2016-10-31T12:00:00Z 2016-12-11T08:40:03Z Our unique parts are based off of E. coli thermosensors designed by Neupert et. al. It utilizes the distinct thermosensor U1, with different expression patterns at various temperature levels. At elevated temperatures, the U1 thermosensor releases its hairpin structure and allows the RBS to be readily accessible to the ribosome, enabling increased expression of our desired gene. We picked U1 because of its unique trait that allows for the detection of increasing gene expression levels ranging from 22˚C to 37˚C. We did not make any modifications to the thermosensor genetic sequences given by Neupert et. al. Our plasmid includes a standard selectable marker, chloramphenicol, pP-T5 promoter, the U1 RBS, mTurquoise FP, pT-T7 terminator, and a high copy ORI. false false _848_ 34410 34409 9 false Less than 2kb for DNA 2.0 to synthesize. No Bsa I restriction site sequence. No palindromic repeats longer than 5 bp or repeating nucleotides longer than approximately 10 bp. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50007_sequence 1 ggatcccaccttactagtctgcagaaggagatataccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z