BBa_M50008 1 BBa_M50008 U10 Thermosensitive 5'-UTR (includes RBS) 2016-10-31T12:00:00Z 2016-12-11T08:40:54Z Neupert, J., Karcher, D., & Bock, R. 2008. Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Research. 36(19): e124. Synthetically designed RBS site with internal hairpin for thermosensitivity. U10 RBS, contains the Shine Dalgarno sequence and an anti-Shine-Dalgarno sequence which will form a hairpin structure in mRNA that inhibits ribosomes from binding to the mRNA to initiate translation. Normal protein synthesis at 37 degrees Celsius but from thirty degrees Celsius and below little to no protein is made. false false _848_ 34410 34422 9 false No BsaI sites, no palindromic repeats greater than 10bp, not over 2kbp. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50008_sequence 1 ggatcctctccttactagtctgcagaaggagatataccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z