BBa_M50012 1 BBa_M50012 arsR gene 2016-10-26T11:00:00Z 2016-10-27T06:20:30Z The part can be found in E. Coli chromosomal and plasmid DNA. This part is a subset of the ars operon, which consists of a promoter and 5 genes: arsR, arsD, arsA, arsB, and arsC. This part consists of only arsR, a protein that represses the transcription of the ars operon; when bound to arsenic the protein arsR no longer represses the operon and the operon is transcribed. false false _848_ 34386 34386 9 false None false Maddie Hayes-Lattin BBa_M50012_sequence 1 atgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z