BBa_M50013 1 BBa_M50013 Arsenic Sensor (arsR operon promoter and arsR gene) 2016-10-26T11:00:00Z 2016-12-09T08:57:24Z This part can be found in E. Coli chromosomal and plasmid DNA. This part is a subset of the ars operon, which consists of a promoter and 5 genes: arsR, arsD, arsA, arsB, and arsC. arsR is a protein that represses the transcription of the ars operon; when bound to arsenic the protein arsR no longer represses the operon and operon is transcribed. The arsD, arsA, arsB, and arsC encode proteins that give E. Coli arsenic resistance. This part consists of only the promoter and the arsR protein-encoding region to be used as an arsenic sensor. false false _848_ 34386 34386 9 false None false Maddie Hayes-Lattin component2530562 1 BBa_M50012 component2530561 1 BBa_M50010 annotation2530561 1 BBa_M50010 range2530561 1 1 16 annotation2530562 1 BBa_M50012 range2530562 1 23 386 BBa_M50012 1 BBa_M50012 arsR gene 2016-10-26T11:00:00Z 2016-10-27T06:20:30Z The part can be found in E. Coli chromosomal and plasmid DNA. This part is a subset of the ars operon, which consists of a promoter and 5 genes: arsR, arsD, arsA, arsB, and arsC. This part consists of only arsR, a protein that represses the transcription of the ars operon; when bound to arsenic the protein arsR no longer represses the operon and the operon is transcribed. false false _848_ 34386 34386 9 false None false Maddie Hayes-Lattin BBa_M50010 1 BBa_M50010 Arsenic sensor: ars operon Promoter 2016-10-26T11:00:00Z 2016-10-27T06:17:39Z This part can be found on E. Coli chromosomal and plasmid DNA. This part is a subset of the ars operon, which consists of a promoter and 5 genes: arsR (ars operon repressor) and arsD, arsA, arsB, and arsC (arsenic resistant proteins). This part consists of only the promoter of the operon. false false _848_ 34386 34386 9 false None false Maddie Hayes-Lattin BBa_M50010_sequence 1 caatcaggagcgcaat BBa_M50012_sequence 1 atgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagct BBa_M50013_sequence 1 caatcaggagcgcaattactagatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z