BBa_M50014 1 BBa_M50014 cusR promoter (E. coli) 2016-10-26T11:00:00Z 2016-12-01T12:13:31Z The 250 nucleotides before the cusR protein in E. Coli str. K-12 substr. MG1655 (from: http://microbesonline.org/cgi-bin/fetchLocus.cgi?locus=14707&disp=0) long false false _848_ 34381 34381 9 false none. false Anika Naidu, Derek Wang BBa_M50014_sequence 1 gcacgggcattgccggacgctgataatccggtgccagtgaacaaccggttagcgcaagggccacacaaaatggcagaagtttacaaggagacataggctcataatttctggtgattttatgccgccaactttactcgccaggctctgattttccggtgacagaaaaatgacaaaattgtcattttgccaataagcgattgccatctgatcccgctactctagaattgcccgggcaacatgcggaggaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z