BBa_M50016 1 BBa_M50016 Promoter, RBS and GolS Activator for Gold Detection 2016-10-26T11:00:00Z 2016-10-27T07:34:50Z This part was drawn from York iGEM in 2013, found at this link: http://parts.igem.org/Part:BBa_K1127008 Included in this composite part is a promoter, RBS, and GolS protein for gold detection. The GolS protein, in the presence of Au forms a metal-protein complex that then binds to the promoter as an activator, up-regulating downstream gene expression. true false _848_ 34398 34398 9 false We inserted Bsal (FW) and Bsal (RV) for synthesis with the RBS for GFP and GFP in the overall plasmid. The sequence for the sensor and actuator for this device is: Bsal (FW)_Promoter_RBS_GolS_Bsal (RV)_RBS_GFP. false Maurice Chiang component2530579 1 BBa_M50020 annotation2530579 1 BBa_M50020 range2530579 1 1 38 BBa_M50020 1 BBa_M50020 Promoter for GolS + GFP 2016-10-26T11:00:00Z 2016-10-27T06:56:17Z This part came from York iGEM in 2013. Their full project can be found at: http://parts.igem.org/Part:BBa_K1127008. This promoter can be bound by GolS. The promoter allows for some baseline transcription, and in the presence of Au, the GolS forms a protein complex which can bind to and up-regulate the gene expression of the downstream sequence. false false _848_ 34398 34398 9 false This promoter is a part of a larger plasmid, of which the design is as follows: Bsal (FW)_RBS_GolS_Bsal (RV)_RBS_GFP. As a part of this larger plasmid, the promoter has to be responsive to the GolS-Au protein complex. false Maurice Chiang annotation2530576 1 GolS Promoter range2530576 1 1 38 BBa_M50016_sequence 1 cttgaccttcccacaatggcaagctttaggctttctga BBa_M50020_sequence 1 cttgaccttcccacaatggcaagctttaggctttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z