BBa_M50018 1 BBa_M50018 Sigma-32 Induced (Heat sensitive) Promoter 2016-10-26T11:00:00Z 2016-12-11T09:47:06Z Promoter sequence based on GroE gene promoter (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC193967/figure/f1/, http://www.sciencedirect.com/science/article/pii/037811199490846X) Promoter which binds preferentially to RNA polymerase holoenzyme containing sigma factor 32, which is upregulated with heat false false _848_ 34405 34405 9 false false Taylor Merkel, Chloe Thai, Julia Schulz BBa_M50018_sequence 1 tttcccccttgaaggggcgaagcctcatccccattta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z