BBa_M50020 1 BBa_M50020 Promoter for GolS + GFP 2016-10-26T11:00:00Z 2016-10-27T06:56:17Z This part came from York iGEM in 2013. Their full project can be found at: http://parts.igem.org/Part:BBa_K1127008. This promoter can be bound by GolS. The promoter allows for some baseline transcription, and in the presence of Au, the GolS forms a protein complex which can bind to and up-regulate the gene expression of the downstream sequence. false false _848_ 34398 34398 9 false This promoter is a part of a larger plasmid, of which the design is as follows: Bsal (FW)_RBS_GolS_Bsal (RV)_RBS_GFP. As a part of this larger plasmid, the promoter has to be responsive to the GolS-Au protein complex. false Maurice Chiang annotation2530576 1 GolS Promoter range2530576 1 1 38 BBa_M50020_sequence 1 cttgaccttcccacaatggcaagctttaggctttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z