BBa_M50023 1 BBa_M50023 UV sensitive promoter 2016-10-26T11:00:00Z 2016-10-27T06:56:05Z We are using the same promoter as the iGEM Columbian Team 2007. The vector will be expressed in an E. coli host. We've included the BCA1(FW) cut site and BCA1 (Rev) site on either side of our UV (360 nm) sensitive promoter. We want to use this promoter to drive the expression of GFP in the plasmid EColi_Promoter_Cassette. false false _848_ 34399 34399 9 false We wanted to use a promoter that is compatible with E. Coli. In addition, we have flanked the promoter with BSA1 sequences that will allow the BSA enzyme to cut the promoter into another plasmic. false Elisa Liu annotation2530577 1 Bsa1_rev range2530577 1 87 98 annotation2530575 1 Bsa1-fw range2530575 1 1 11 BBa_M50023_sequence 1 ggtctctggggggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggttaaaatgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z