BBa_M50020 1 BBa_M50020 Promoter for GolS + GFP 2016-10-26T11:00:00Z 2016-10-27T06:56:17Z This part came from York iGEM in 2013. Their full project can be found at: http://parts.igem.org/Part:BBa_K1127008. This promoter can be bound by GolS. The promoter allows for some baseline transcription, and in the presence of Au, the GolS forms a protein complex which can bind to and up-regulate the gene expression of the downstream sequence. false false _848_ 34398 34398 9 false This promoter is a part of a larger plasmid, of which the design is as follows: Bsal (FW)_RBS_GolS_Bsal (RV)_RBS_GFP. As a part of this larger plasmid, the promoter has to be responsive to the GolS-Au protein complex. false Maurice Chiang annotation2530576 1 GolS Promoter range2530576 1 1 38 BBa_M50026 1 BBa_M50026 Gold Detection Device with Promoter RBS and GolS 2016-10-26T11:00:00Z 2016-12-08T08:43:41Z This part was drawn from York iGEM in 2013, found at this link: http://parts.igem.org/Part:BBa_K1127008 We inserted Bsal (FW) and Bsal (RV) for synthesis with the RBS for GFP and GFP in the overall plasmid. The sequence for the sensor and actuator for this device is: Bsal (FW)_Promoter_RBS_GolS_Bsal (RV)_RBS_GFP. false false _848_ 34398 34398 9 false We designed this device to be inserted in a plasmid with the RBS for GFP and GFP. Thus there are Bsal sites at the beginning and end of the part so that it can be inserted. false Maurice Chiang component2530585 1 BBa_M50024 component2530583 1 BBa_M50020 component2530587 1 BBa_M50025 annotation2530583 1 BBa_M50020 range2530583 1 1 38 annotation2530585 1 BBa_M50024 range2530585 1 47 56 annotation2530587 1 BBa_M50025 range2530587 1 65 538 BBa_M50024 1 BBa_M50024 RBS for Gold detection plasmid 2016-10-26T11:00:00Z 2016-10-27T07:29:30Z asdf asdf false false _848_ 34408 34408 9 false asdf false James Benjami Hu annotation2530580 1 RBS range2530580 1 1 10 BBa_M50025 1 BBa_M50025 GolS 2016-10-26T11:00:00Z 2016-12-10T08:40:55Z asdf asdf false false _848_ 34398 34408 9 false asdf false James Benjamin Hu annotation2530581 1 GolS Gene range2530581 1 1 474 BBa_M50026_sequence 1 cttgaccttcccacaatggcaagctttaggctttctgatactagagcaaagaggagtactagagaaaactagaatgaacatcggtaaagctgctaaagcttctaaagtttctgctaaaatgatccgttactacgaacagatcggtctgatcccggctgcttctcgtaccgactctggttaccgtgcttacacccaggctgacgttaaccagctgcacttcatccgtcgtgctcgtgacctgggtttctctgttgctgaaatctctgacctgctgaacctgtggaacaaccagtctcgtcagtctgctgacgttaaacgtctggctcagacccacatcgacgaactggaccgtcgtatccagaacatgcagcacatggctcagaccctgaaagctctgatccactgctgcgctggtgacgctctgccggactgcccgatcctgcacaccctgggtcagccggacgactctgaaccggaagctcgtaccggtgctgttctgcgtcgtccgcgtcgtcacggtctggctaaacgtctgtaa BBa_M50024_sequence 1 caaagaggag BBa_M50020_sequence 1 cttgaccttcccacaatggcaagctttaggctttctga BBa_M50025_sequence 1 aaaactagaatgaacatcggtaaagctgctaaagcttctaaagtttctgctaaaatgatccgttactacgaacagatcggtctgatcccggctgcttctcgtaccgactctggttaccgtgcttacacccaggctgacgttaaccagctgcacttcatccgtcgtgctcgtgacctgggtttctctgttgctgaaatctctgacctgctgaacctgtggaacaaccagtctcgtcagtctgctgacgttaaacgtctggctcagacccacatcgacgaactggaccgtcgtatccagaacatgcagcacatggctcagaccctgaaagctctgatccactgctgcgctggtgacgctctgccggactgcccgatcctgcacaccctgggtcagccggacgactctgaaccggaagctcgtaccggtgctgttctgcgtcgtccgcgtcgtcacggtctggctaaacgtctgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z