BBa_M50031 1 BBa_M50031 pP-T5 promoter 2016-11-01T12:00:00Z 2016-11-01T06:29:33Z Gene Designer 2.0 Generic E. coli T5 promoter obtained from Gene Designer 2.0 false false _848_ 34410 34409 9 false None. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50031_sequence 1 aaatcatgaaaaatttatttgctttgtgagcggataacaattataata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z