BBa_M50032 1 BBa_M50032 pT-T7 terminator 2016-11-01T12:00:00Z 2016-11-01T06:29:47Z Gene Designer 2.0 Generic bacteriophage T7 terminator obtained from Gene Designer 2.0. false false _848_ 34410 34409 9 false None. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50029 1 BBa_M50029 mTurquoise2 FP 2016-11-01T12:00:00Z 2016-11-01T06:29:00Z Bajar, B., et al. 2016. Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Nature Methods. Fluorescent protein excitation wavelength= 434 nm; emission wavelength=474 nm Excitation state does not overlap with those of mKO2 FP and Clover FP false false _848_ 34410 34409 9 false No BsaI restriction sites false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50033 1 BBa_M50033 U1_mTurquoise2, IPTG-induced, CAM resistant Thermosensor Construct 2016-11-01T12:00:00Z 2016-12-11T07:37:42Z Neupert, J., Karcher, D., and Bock, R. 2008. Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Research. 36(19): e124. Bajar, B., et al. 2016. Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Nature Methods. At elevated temperatures, the U1 thermosensor releases its hairpin structure and allows the RBS to be readily accessible to the ribosome, enabling increased expression of our desired gene. U1 has a unique trait that allows for the detection of increasing gene expression levels ranging from 22˚C to 37˚C. It contains a pP-T5 promoter, U1 RBS, mTurquoise2, and a pT-T7 terminator. false false _848_ 34409 34409 9 false No BsaI restriction sites. Under 2kb for synthesis using DNA 2.0. false Cale Lester, Raquel Freeman, Tristan Yeung component2531617 1 BBa_M50031 component2531618 1 BBa_M50007 component2531620 1 BBa_M50032 component2531619 1 BBa_M50029 annotation2531617 1 BBa_M50031 range2531617 1 1 48 annotation2531619 1 BBa_M50029 range2531619 1 87 806 annotation2531620 1 BBa_M50032 range2531620 1 807 854 annotation2531618 1 BBa_M50007 range2531618 1 49 86 BBa_M50031 1 BBa_M50031 pP-T5 promoter 2016-11-01T12:00:00Z 2016-11-01T06:29:33Z Gene Designer 2.0 Generic E. coli T5 promoter obtained from Gene Designer 2.0 false false _848_ 34410 34409 9 false None. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50007 1 BBa_M50007 U1 Thermosensitive 5'-UTR (includes RBS) 2016-10-31T12:00:00Z 2016-12-11T08:40:03Z Our unique parts are based off of E. coli thermosensors designed by Neupert et. al. It utilizes the distinct thermosensor U1, with different expression patterns at various temperature levels. At elevated temperatures, the U1 thermosensor releases its hairpin structure and allows the RBS to be readily accessible to the ribosome, enabling increased expression of our desired gene. We picked U1 because of its unique trait that allows for the detection of increasing gene expression levels ranging from 22˚C to 37˚C. We did not make any modifications to the thermosensor genetic sequences given by Neupert et. al. Our plasmid includes a standard selectable marker, chloramphenicol, pP-T5 promoter, the U1 RBS, mTurquoise FP, pT-T7 terminator, and a high copy ORI. false false _848_ 34410 34409 9 false Less than 2kb for DNA 2.0 to synthesize. No Bsa I restriction site sequence. No palindromic repeats longer than 5 bp or repeating nucleotides longer than approximately 10 bp. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50033_sequence 1 aaatcatgaaaaatttatttgctttgtgagcggataacaattataataggatcccaccttactagtctgcagaaggagatatacccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgtcctggggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactactttagcgacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcggcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaactagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_M50029_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgtcctggggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactactttagcgacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcggcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa BBa_M50007_sequence 1 ggatcccaccttactagtctgcagaaggagatataccc BBa_M50031_sequence 1 aaatcatgaaaaatttatttgctttgtgagcggataacaattataata BBa_M50032_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z