BBa_M50032 1 BBa_M50032 pT-T7 terminator 2016-11-01T12:00:00Z 2016-11-01T06:29:47Z Gene Designer 2.0 Generic bacteriophage T7 terminator obtained from Gene Designer 2.0. false false _848_ 34410 34409 9 false None. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50008 1 BBa_M50008 U10 Thermosensitive 5'-UTR (includes RBS) 2016-10-31T12:00:00Z 2016-12-11T08:40:54Z Neupert, J., Karcher, D., & Bock, R. 2008. Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Research. 36(19): e124. Synthetically designed RBS site with internal hairpin for thermosensitivity. U10 RBS, contains the Shine Dalgarno sequence and an anti-Shine-Dalgarno sequence which will form a hairpin structure in mRNA that inhibits ribosomes from binding to the mRNA to initiate translation. Normal protein synthesis at 37 degrees Celsius but from thirty degrees Celsius and below little to no protein is made. false false _848_ 34410 34422 9 false No BsaI sites, no palindromic repeats greater than 10bp, not over 2kbp. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50034 1 BBa_M50034 U10_mKO2, IPTG inducible, KAN resistant Thermosensor Construct 2016-11-01T12:00:00Z 2016-12-11T08:10:23Z Bajar, B., et al. 2016. Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Nature Methods. Neupert, J., Karcher, D., and Bock, R. 2008. Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Research. 36(19): e124. At elevated temperatures, the U10 thermosensor releases its hairpin structure and allows the RBS to be readily accessible to the ribosome, enabling increased expression of our desired gene. The U10 thermosensor mainly exhibits activity at approximately 37˚C. Other temperatures such as 22˚C and 30˚C show very low gene expression levels. We picked U10 because of its higher specificity as a thermosensor in our chosen temperature ranges (22˚C - 37˚C). We did not make any modifications to the thermosensor genetic sequences given by Neupert, J., Karcher, D., and Bock, R. false false _848_ 34409 34409 9 false Removed 2 BsaI restriction sites. Under 2 kb for synthesis by DNA 2.0. false Cale Lester, Raquel Freeman, Tristan Yeung component2531622 1 BBa_M50008 component2531621 1 BBa_M50031 component2531624 1 BBa_M50032 component2531623 1 BBa_M50030 annotation2531621 1 BBa_M50031 range2531621 1 1 48 annotation2531624 1 BBa_M50032 range2531624 1 745 792 annotation2531623 1 BBa_M50030 range2531623 1 88 744 annotation2531622 1 BBa_M50008 range2531622 1 49 87 BBa_M50030 1 BBa_M50030 mKO2 2016-11-01T12:00:00Z 2016-11-01T06:29:18Z Bajar, B., et al. 2016. Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Nature Methods. Fluorescent Protein excitation wavelength= 551 nm; emission wavelength=565 nm Excitation wavelength does not overlap with mTurquoise2 FP or Clover FP false false _848_ 34410 34409 9 false Two BsaI sites removed. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50031 1 BBa_M50031 pP-T5 promoter 2016-11-01T12:00:00Z 2016-11-01T06:29:33Z Gene Designer 2.0 Generic E. coli T5 promoter obtained from Gene Designer 2.0 false false _848_ 34410 34409 9 false None. false Cale Lester, Raquel Freeman, Tristan Yeung BBa_M50008_sequence 1 ggatcctctccttactagtctgcagaaggagatataccc BBa_M50034_sequence 1 aaatcatgaaaaatttatttgctttgtgagcggataacaattataataggatcctctccttactagtctgcagaaggagatatacccatggtgagtgtgattaaacctgagatgaagatgaggtactacatggacggctccgtcaatgggcatgagttcacaattgaaggtgaaggcacaggcagaccttacgagggacatcaagagatgacactacgcgtcacaatggccgagggcgggccaatgcctttcgcgtttgacttagtgtcacacgtgttctgttacggccacagagtatttactaaatatccagaagagataccagactatttcaaacaagcatttcctgaaggcctgtcatgggaaaggtcgttggagttcgaagatggtgggtccgcttcagtcagtgcgcatataagccttagaggaaacaccttctaccacaaatccaaatttactggggttaactttcctgccgatggtcctatcatgcaaaaccaaagtgttgattgggagccatcaaccgagaaaattactgccagcgacggagttctgaagggtgatgttacgatgtacctaaaacttgaaggaggcggcaatcacaaatgccaaatgaagactacttacaaggcggcaaaagagattcttgaaatgccaggagaccattacatcggccatcgcctcgtcaggaaaaccgaaggcaacattactgagcaggtagaagatgcagtagctcattcctaactagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_M50030_sequence 1 atggtgagtgtgattaaacctgagatgaagatgaggtactacatggacggctccgtcaatgggcatgagttcacaattgaaggtgaaggcacaggcagaccttacgagggacatcaagagatgacactacgcgtcacaatggccgagggcgggccaatgcctttcgcgtttgacttagtgtcacacgtgttctgttacggccacagagtatttactaaatatccagaagagataccagactatttcaaacaagcatttcctgaaggcctgtcatgggaaaggtcgttggagttcgaagatggtgggtccgcttcagtcagtgcgcatataagccttagaggaaacaccttctaccacaaatccaaatttactggggttaactttcctgccgatggtcctatcatgcaaaaccaaagtgttgattgggagccatcaaccgagaaaattactgccagcgacggagttctgaagggtgatgttacgatgtacctaaaacttgaaggaggcggcaatcacaaatgccaaatgaagactacttacaaggcggcaaaagagattcttgaaatgccaggagaccattacatcggccatcgcctcgtcaggaaaaccgaaggcaacattactgagcaggtagaagatgcagtagctcattcctaa BBa_M50031_sequence 1 aaatcatgaaaaatttatttgctttgtgagcggataacaattataata BBa_M50032_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z