BBa_M50037 1 BBa_M50037 Glucose Binding Protein of Thermus thermophilus 2016-12-11T12:00:00Z 2016-12-11T05:29:45Z This GBP comes from the genomic sequence of Thermus thermophilus. The complete bacterial genome was published by Henne et al. in Nature Biotechnology in 2004 (https://www.ncbi.nlm.nih.gov/pubmed/15064768), and the particular GBP was characterized in a 2006 study by Cuneo et al. in the Journal of Molecular Biology (https://www.ncbi.nlm.nih.gov/pubmed/16904687). This bacterial glucose binding protein (GBP) is derived from the genome sequence of Thermus thermophilus that was published in 2004 by Henne et al. In 2006, Cuneo et al. analyzed the sequence of this particular GBP, determined its X-ray crystal structure and characterized the stability of glucose-binding. The GBP is composed of two domains separated by a hinge, maintaining an open conformation when unbound to glucose and a closed conformation when bound. When flanked with an RFP fluorophore on the N-terminus and a GFP fluorophore on the C-terminus, these conformation changes facilitated FRET-based analysis of glucose binding. In addition, this GBP was selected for its reasonably short sequence length (1242bp) and stable glucose binding ability (Kd value of 0.08(+/- 0.03) mM). According to Cuneo et al., this T. thermophilus GBP shares more structural homology with maltose binding proteins than glucose binding proteins. However, we were able to obtain FRET when glucose was added, suggesting that glucose is a ligand for this protein. false false _848_ 34390 34390 9 false This GBP sequence was optimized for use in E. coli. Also, start and stop codons were removed to facilitate fusion to the other components of our construct. false Amanda Urke annotation2532563 1 Deletion of stop codon to facilitate fusion to linker and fluorophore range2532563 1 1239 1239 annotation2532562 1 Deletion of start codon to facilitate fusion to linker and fluorophore range2532562 1 1 1 BBa_M50037_sequence 1 cgcaagtggttacttgcaatcggcatggtgctgggtttaagtgccttagcccaagggggaaagcttgaaatttttagttggtgggctggcgacgagggccctgcgctggaagcgcttatccgtttgtataaacagaagtacccaggtgtagaggttattaatgccacggtaacgggcggtgcgggtgtgaacgcacgtgcggtgttgaaaacacgcatgttaggaggcgacccaccagatactttccaagtgcatgcgggaatggagttgattggcacatgggtcgtcgcaaaccgtatggaggacctgtcggctttattccgtcaggaaggatggttgcaggcatttcctaagggattgattgacctgatctcttacaaaggcggaatctggtcagtccccgttaatatccaccgcagcaacgtcatgtggtaccttcctgctaagttgaaagagtggggtgtaaacccacctcgtacatgggacgaatttttggccacttgtcaaacattaaagcaaaagggtttagaagcaccccttgcattgggcgaaaattggacccagcagcatctgtgggaatcagtggccttggcggtattgggtccagatgactggaataatctttggaacgggaagttgaagtttacggaccccaaggcagttcgcgcttgggaggtattcggtcgcgtacttgactgtgcgaataaagatgccgctgggctgagctggcaacaagcggtagatcgtgtagtacaaggaaaagccgctttcaacgtgatgggggactgggccgcagggtatatgaccacgaccctgaagttgaagccgggcaccgacttcgcttgggccccttctccgggtactcaaggagtttttatgatgctgtcggactcctttggacttccaaaaggagctaagaatcgtcaaaacgctatcaattggttgcgtttagtgggttcgaaagagggacaagacacatttaacccattaaagggttccattgcagcgcgtttggatagcgatccatccaagtacaatgcatatgggcagtccgccatgcgtgattggcgttctaatcgtatcgttggctcgttggtccacggtgcggtcgctccagagtcattcatgtctcagttcggcacggtaatggaaatctttcttcagacacgcaacccgcaggccgccgcgaacgctgctcaggccattgcggatcaggtgggactgggccgcttggggcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z