BBa_M50043 1 BBa_M50043 HIV-1 U3 Region 2016-12-08T12:00:00Z 2016-12-08T05:28:28Z 2006. HIV-1, complete genome. GenBank:AF033819.3. This sequence is the terminal 40 base pairs of the HIV-1 U3 region. It is recognized by HIV-1 integrase at the 5' end of the HIV genome prior to integration. false false _848_ 34431 34431 9 false None false Michael Herschl BBa_M50043_sequence 1 actggaagggctaattcactcccaaagaagacaagatatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z