BBa_M50044 1 BBa_M50044 HIV-1 U5 Region 2016-12-08T12:00:00Z 2016-12-08T05:31:14Z 2006. HIV-1, complete genome. GenBank:AF033819.3. This sequence is the terminal 40 base pairs of the HIV-1 U5 region. It is recognized by HIV-1 integrase at the 3' end of the HIV genome prior to integration. false false _848_ 34431 34431 9 false None false Michael Herschl BBa_M50044_sequence 1 cctcagacccttttagtcagtgtggaaaatctctagcagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z