BBa_M50048 1 BBa_M50048 Atrazine riboswitch 2016-12-10T12:00:00Z 2016-12-11T11:22:31Z Riboswitch components: http://parts.igem.org/Part:BBa_K784005 Atrazine aptamer: Williams, R., Crihfield, C., Gattu, S., Holland, L., & Sooter, L. (2014). In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine. IJMS International Journal of Molecular Sciences, 15(8), 14332-14347. doi:10.3390/ijms150814332 This is a riboswitch consisting of an RNA aptamer that recognizes atrazine, and a ribosome binding site. It is based on BBa_K784005, with the theophylline aptamer exchanged for an atrazine aptamer. In the absence of atrazine, the RNA transcript of this part has excessive base pairing in the 5??? UTR, folding the RNA to block binding at the RBS and thus prevent translation. When atrazine is present, it binds to the aptamer sequence, altering the shape of the transcript to expose the RBS and allow translation of any downstream protein sequences. false false _848_ 34438 34438 9 false We had to replace the aptamer in the original riboswitch with an aptamer that would target our molecule of interest. false Eleanor Glockner, Jack Andraka annotation2532386 1 atrazine aptamer range2532386 1 18 90 annotation2532387 1 RBS range2532387 1 91 111 annotation2532385 1 5' UTR range2532385 1 1 17 BBa_M50048_sequence 1 gactcactataggtacctgtaccgtctgagcgattcgtacgaacggctttgtactgtttgcactggcagccagtcagtgttaaggagtgcccctgctaaggtaacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z