BBa_M50054 1 BBa_M50054 PETase double mutant I208V and R90A 2016-12-11T12:00:00Z 2016-12-12T12:59:47Z Wild type PETase sequence is originally from Ideonella sakaiensis. This is a mutant of PETase that combines two mutations designed by the 2016 iGEM Tianjin team. Wild type PETase shows emzyme ability to hydrolyze Polyethylene terephthalate (PET), commonly used for plastics. The two mutations are the 208th amino acid (changed from isoleucine(I) to valine(V)) and the 90th amino acid (changed from arginine (R) to alanine (A)), and each individual mutant has been showed by the Tianjin team to improve the catalytic activity of PET. This sequence combines both mutations, and is optimized for Escherichia coli. false false _848_ 34425 34425 9 false The design is based on the hypothesis that the combination of the two mutations will further enhance the PETase catalytic activity. false Lucy Maynard, Doris Mai and Amy Weissenbach annotation2532581 1 R90A range2532581 1 268 270 annotation2532577 1 PETase coding region range2532577 1 4 873 annotation2532578 1 6 hig tag range2532578 1 874 891 annotation2532576 1 start codon range2532576 1 1 3 annotation2532580 1 I208V range2532580 1 622 624 annotation2532579 1 stop codon range2532579 1 892 894 BBa_M50054_sequence 1 atgaactttccccgcgcttcccgtcttatgcaggcggctgtgttgggcggattaatggcggtcagcgcggcggcaacggctcagacaaatccttatgcacgcggccctaatcccactgccgcttcccttgaagctagtgcaggccctttcaccgttcgctcgtttaccgtgtcccgcccgtccgggtatggcgcggggacggtatattatccgacaaatgccggcggaaccgtcggtgctatcgctatcgtgcctggctacactgctgcccagtcctcaattaaatggtggggaccgcgtttagcaagccatggttttgtcgtaattactatcgatactaattcgacccttgaccaaccgtcctctcgcagcagtcagcagatggcggctcttcgtcaagttgcaagcttgaatgggacatcaagctcgccgatttatggtaaggtggataccgcgcgtatgggcgttatgggctggtcgatgggcggaggtgggtcgttgatttctgcggccaacaaccccagtcttaaagctgctgccccccaagcgccctgggactctagtacgaacttcagttccgtcacagtgcctacattaatctttgcgtgcgagaatgacagcgtagccccggtgaattcaagcgccttaccgatctacgatagtatgtcccgtaatgctaaacagtttttagagattaacggggggtcccactcgtgtgctaattctggcaactcgaatcaggctctgattggcaaaaaaggtgttgcctggatgaaacgctttatggacaatgacactcgctactcgacgttcgcttgtgagaaccccaatagtacgcgtgtcagtgatttccgcaccgcgaactgcagtcaccatcatcaccatcattagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z