BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_P0350 1 BBa_P0350 PoPS -> cI (HK022) [S0158] 2004-04-26T11:00:00Z 2015-05-08T01:14:10Z -- No description -- false false _1_ 0 24 7 It's complicated false false Randy Rettberg component944677 1 BBa_B0033 component944711 1 BBa_B0012 component944693 1 BBa_C0050 component944701 1 BBa_B0010 annotation944701 1 BBa_B0010 range944701 1 795 874 annotation944693 1 BBa_C0050 range944693 1 18 761 annotation944677 1 BBa_B0033 range944677 1 1 11 annotation944711 1 BBa_B0012 range944711 1 883 923 BBa_C0050 1 cI HK022 cI repressor from phage HK022 (+LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage HK022. Released HQ 2013 Coding region for the HK022 bacteriophage cI protein. cI binds to the HK022 pR regulator (BBa_R0050). It represses transcription of the protein encoded by the sequence 3' to the pR region. This coding sequence does not contain a RBS.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P> References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P>Derived from <genbank>STHK022N</genbank>.<br> <br> Response from John Little (Arizona) regarding the start of HK022 cI<br> <br> From: <jlittle@email.arizona.edu> <br> Date: Tue Jan 21, 2003 4:39:21 PM US/Eastern <br> To: "Drew Endy" <endy@MIT.EDU><br> Subject: RE: hk022 cI start (naive question)? <br> Hello Drew and Michael, I seriously doubt that the extra 27 aa are part of CI. It doesn't make sense in terms of the biology, for sure. In any case, the protein we characterized starts where Carlson and Little stated; as I recall, oR3 partially overlaps the start of cI. I have a vague memory of some possibly interesting biology, having to do with multicopy plasmids. I don't recall the findings themselves. Anyway, one possible explanation was that this extra N-terminal addition was made (e.g. from the pRE promoter, or from a message that arose from transcription around the entire plasmid), making a protein with altered functions. We never followed it up. <br> Good luck <br> John<br> <br> -- Original Message -- <br> Date: Sun, 19 Jan 2003 15:26:26 -0500 <br> Subject: hk022 cI start (naive question)? <br> Cc: elowitm@rockefeller.edu <br> To: jlittle@u.arizona.edu <br> From: Drew Endy <endy@MIT.EDU> <br> Hi John, I'm sitting here with Michael Elowitz and we're working through the sequence for HK022 cI. We noticed that the annotation from NC_002166 includes an "extra" 81 base pairs upstream of what we thought of as the actual start. It looks like this extra DNA extends into the PR regulatory region. We're wondering what's going on here? I'm guessing this is well documented somewhere. Thanks for any pointers/info! <br> Drew<P> It is unknown whether there is cross-talk between this repressor and Lambda cI regulatory region, 434 cI regulatory region and P22 regulatory region. true Reshma Shetty annotation1735 1 cI HK022 range1735 1 1 744 annotation2213990 1 Help:Barcodes range2213990 1 745 769 annotation1737 1 OR3 partial range1737 1 1 8 annotation1734 1 2 range1734 1 739 744 annotation7033 1 BBa_C0050 range7033 1 1 744 annotation1736 1 SsrA range1736 1 706 738 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_P0350_sequence 1 tcacacaggactactagatggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0033_sequence 1 tcacacaggac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0050_sequence 1 atggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z