BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation1751 1 stop range1751 1 682 687 annotation7036 1 BBa_C0053 range7036 1 1 687 annotation1750 1 LVA range1750 1 649 681 annotation1747 1 cII p22 range1747 1 1 648 annotation2213993 1 Help:Barcodes range2213993 1 688 712 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_P0457 1 BBa_P0457 PoPS -> P22 lambdoid c2 protein 2005-06-29T11:00:00Z 2015-05-08T01:14:11Z -- No description -- false false _41_ 0 126 6 It's complicated false false Reshma Shetty component1558155 1 BBa_C0053 component1558143 1 BBa_B0034 component1558175 1 BBa_B0011 component1558167 1 BBa_B0012 annotation1558143 1 BBa_B0034 range1558143 1 1 12 annotation1558167 1 BBa_B0012 range1558167 1 739 779 annotation1558155 1 BBa_C0053 range1558155 1 19 705 annotation1558175 1 BBa_B0011 range1558175 1 788 833 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_P0457_sequence 1 aaagaggagaaatactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0034_sequence 1 aaagaggagaaa BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z