BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_C0076 1 cinI autoinducer synthetase 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 cinI codes for an autoinducer synthetase which utilizes SAM to make O3-C14:1-HSL. In complex with O3-C14:1-HSL, CinR (BBa_C0077) binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tga -> tAaTAA true crackdots annotation306586 1 LVA range306586 1 664 696 annotation2214001 1 Help:Barcodes range2214001 1 703 727 annotation301035 1 CinI range301035 1 1 663 BBa_P0476 1 BBa_P0476 B0034.C0076.B0015 2004-07-27T11:00:00Z 2015-05-08T01:14:11Z -- No description -- false false _11_1_ 0 60 7 It's complicated false false cconboy component1014765 1 BBa_B0034 component1014781 1 BBa_B0010 component1014791 1 BBa_B0012 component1014775 1 BBa_C0076 annotation1014781 1 BBa_B0010 range1014781 1 754 833 annotation1014765 1 BBa_B0034 range1014765 1 1 12 annotation1014775 1 BBa_C0076 range1014775 1 19 720 annotation1014791 1 BBa_B0012 range1014791 1 842 882 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0076_sequence 1 atgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_P0476_sequence 1 aaagaggagaaatactagatgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z