BBa_P1010 1 ccdB ccdB cell death gene 2004-07-27T11:00:00Z 2015-05-08T01:14:11Z Deleted The ccd operon having a constitutive promoter and the ccdB coding region. ccdB protein is lethal in normal cloning strains. This part is used to aid the process of moving a BioBrick part to a new plasmid. A target plasmid carrying P1010 is cut and mixed with the cut insert. Plasmids that recombine are selected against because they kill the cell that picks them up. P1010 is only provided as plasmid or in DB3.1 which is ccdB resistant. true true _11_1_ 0 60 7 Discontinued false false Leon Chan annotation1747336 1 -35 (rev) range1747336 1 618 623 annotation1747334 1 T to C mutation range1747334 1 467 467 annotation1747332 1 ccdB (rev) range1747332 1 29 334 annotation1747333 1 ccdA- (rev) range1747333 1 336 556 annotation1747335 1 -10 (rev) range1747335 1 595 600 BBa_P1010_sequence 1 actggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z