BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_P20020 1 BBa_P20020 Constitutive expression of Zif23-GCN4 2008-04-13T11:00:00Z 2015-05-08T01:14:12Z Composite part. To be entered. false false _41_ 0 126 162 Not in stock false None. false Reshma Shetty component1962183 1 BBa_B0030 component1962197 1 BBa_B0012 component1962194 1 BBa_C2002 component1962195 1 BBa_B0010 component1962178 1 BBa_R0040 annotation1962194 1 BBa_C2002 range1962194 1 84 368 annotation1962197 1 BBa_B0012 range1962197 1 465 505 annotation1962183 1 BBa_B0030 range1962183 1 63 77 annotation1962195 1 BBa_B0010 range1962195 1 377 456 annotation1962178 1 BBa_R0040 range1962178 1 1 54 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_C2002 1 BBa_C2002 Homodimeric zinc finger 2006-05-31T11:00:00Z 2015-08-31T04:07:25Z false false _41_ 0 126 84 Not in stock false false Reshma Shetty annotation1878171 1 Zif268 finger 3 range1878171 1 91 150 annotation1878172 1 DNA recognition site range1878172 1 127 147 annotation1878170 1 DNA recognition site range1878170 1 43 63 annotation1878174 1 GCN4 homodimerization domain range1878174 1 166 261 annotation1878176 1 double stop codon range1878176 1 280 285 annotation1878175 1 hexaHis tag range1878175 1 262 279 annotation1878173 1 domain linker range1878173 1 151 165 annotation1878169 1 Zif268 finger 2 range1878169 1 4 90 annotation1878168 1 start codon range1878168 1 1 3 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_P20020_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgtcatcaccatcaccatcactaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa BBa_C2002_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgtcatcaccatcaccatcactaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z