BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_C2005 1 BBa_C2005 Homodimeric zinc finger 2006-10-20T11:00:00Z 2015-08-31T04:07:25Z This part is derived from BBa_C2002. This is protein based on Scot Wolfe's Zif268-GCN4 homodimeric zinc finger protein. It is a fusion of fingers 2 and 3 of Zif268 (mouse) and the leucine zipper domain of GCN4 (yeast). false false _41_ 0 126 70 Not in stock false This protein contains no tags (like an LVA tag or His tag). false Reshma Shetty annotation1903907 1 double stop codon range1903907 1 262 267 annotation1903902 1 finger 2 of Zif268 range1903902 1 4 90 annotation1903901 1 Zif268.GCN4 range1903901 1 1 267 annotation1903904 1 start codon range1903904 1 1 3 annotation1903906 1 GCN4 leucine zipper homodimerization domain range1903906 1 166 261 annotation1903905 1 domain linker range1903905 1 151 165 annotation1903903 1 finger 3 of Zif268 range1903903 1 91 150 BBa_P2005 1 BBa_P2005 Zif268-GCN4 protein generator 2007-03-27T11:00:00Z 2015-05-08T01:14:12Z To be entered. To be entered. false false _41_ 0 126 70 It's complicated false To be entered. false Reshma Shetty component1922822 1 BBa_B0030 component1922834 1 BBa_B0012 component1922831 1 BBa_C2005 component1922832 1 BBa_B0010 annotation1922822 1 BBa_B0030 range1922822 1 1 15 annotation1922831 1 BBa_C2005 range1922831 1 22 288 annotation1922834 1 BBa_B0012 range1922834 1 385 425 annotation1922832 1 BBa_B0010 range1922832 1 297 376 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_P2005_sequence 1 attaaagaggagaaatactagatgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0030_sequence 1 attaaagaggagaaa BBa_C2005_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z