BBa_R0074 1 PenI Promoter (PenI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z bacillus licheniformis Released HQ 2013 PenP operator from Bacillus Lichenformis. Two operator sites are negatively regulated by PenI (C0074). false false _1_ 0 24 7 In stock false extends slightly past -50 true crackdots annotation319212 1 -10 range319212 1 46 51 annotation319211 1 -35 range319211 1 23 28 annotation319789 1 dimer right half range319789 1 55 76 annotation319788 1 dimer left half range319788 1 31 53 annotation302713 1 PenI range302713 1 1 77 BBa_C0074 1 penI penI repressor from Bacillus licheniformis (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z bacillus licheniformis Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false Since penI is being ported from Bacillus Licheniformis, the sequence was changed within the coding region to reflect codon usage in E.Coli K12. Codons were mapped to the codon of the same usage rank in E.Coli. true crackdots annotation2214009 1 Help:Barcodes range2214009 1 424 448 annotation306563 1 LVA range306563 1 385 417 annotation302638 1 penI range302638 1 1 387 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_Q02740 1 BBa_Q02740 PenI quad part inverter 2006-01-17T12:00:00Z 2015-05-08T01:14:13Z -- No description -- false false _11_ 0 546 11 Not in stock false false Kelly Chang component1794065 1 BBa_B0010 component1794059 1 BBa_C0074 component1794075 1 BBa_B0012 component1794048 1 BBa_B0032 component1794095 1 BBa_R0074 annotation1794065 1 BBa_B0010 range1794065 1 476 555 annotation1794059 1 BBa_C0074 range1794059 1 20 442 annotation1794095 1 BBa_R0074 range1794095 1 613 689 annotation1794075 1 BBa_B0012 range1794075 1 564 604 annotation1794048 1 BBa_B0032 range1794048 1 1 13 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0074_sequence 1 tcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_C0074_sequence 1 atgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_Q02740_sequence 1 tcacacaggaaagtactagatgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_B0032_sequence 1 tcacacaggaaag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z