BBa_C0073 1 mnt (w) mnt repressor (weak) from Salmonella phage P22 (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false dimeric repressor from enterobacteriophage p22 with dissociation constant of 3*10^-8.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> the mutation R10->K10 (ctg->aaa) decreases the binding affinity of the mnt protein to its operator by approximately 12,000 fold (Kd: 2.5e-12 to 3e-8) true crackdots annotation308457 1 T range308457 1 95 97 annotation302631 1 mnt range302631 1 1 249 annotation306535 1 LVA range306535 1 250 282 annotation2214006 1 Help:Barcodes range2214006 1 289 313 annotation308213 1 Arg->Lys (ctg) range308213 1 31 33 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_Q04730 1 BBa_Q04730 mnt (weak) QPI 2006-05-09T11:00:00Z 2015-05-08T01:14:14Z -- No description -- false false _11_ 0 546 11 Not in stock false false Kelly Chang component2251490 1 BBa_B0015 component2251483 1 BBa_C0073 component2251495 1 BBa_R0073 component2251477 1 BBa_B0034 annotation2251483 1 BBa_C0073 range2251483 1 19 331 annotation2251477 1 BBa_B0034 range2251477 1 1 12 annotation2251495 1 BBa_R0073 range2251495 1 477 543 annotation2251490 1 BBa_B0015 range2251490 1 340 468 BBa_R0073 1 Mnt Promoter (Mnt regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z enterobacteriophage p22 Released HQ 2013 false false _1_ 0 24 7 In stock false unsure of where -35 site is true crackdots annotation302669 1 mnt range302669 1 1 67 annotation318638 1 dimer right half range318638 1 32 38 annotation318643 1 -10 range318643 1 47 52 annotation318636 1 dimer left half range318636 1 23 29 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0073_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagtgagtcgtattaattt BBa_C0073_sequence 1 atggcccgggatgatcctcacttcaattttaaaatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_Q04730_sequence 1 aaagaggagaaatactagatggcccgggatgatcctcacttcaattttaaaatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagtgagtcgtattaattt BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z