##gff-version 3
##sequence-region BBa_Q20050 1 478
BBa_Q20050	.	ribosome_entry_site	1	15	.	+	0	ID=BBa_B0030;Name=BBa_B0030
BBa_Q20050	.	ribosome_entry_site	8	12	.	+	0	ID=annotation1702;Name=RBS;Parent=BBa_B0030
BBa_Q20050	.	engineered_region	1	15	.	+	0	ID=annotation7025;Name=BBa_B0030;Parent=BBa_B0030
BBa_Q20050	.	ribosome_entry_site	1	15	.	+	0	ID=annotation1701;Name=RBS-1\Strong;Parent=BBa_B0030
BBa_Q20050	.	terminator	297	376	.	+	0	ID=BBa_B0010;Name=BBa_B0010
BBa_Q20050	.	stem_loop	308	351	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_Q20050	.	engineered_region	297	376	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_Q20050	.	terminator	385	425	.	+	0	ID=BBa_B0012;Name=BBa_B0012
BBa_Q20050	.	stem_loop	392	411	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_Q20050	.	stop_codon	418	418	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_Q20050	.	polyA_site	412	425	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_Q20050	.	engineered_region	385	425	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_Q20050	.	promoter	434	478	.	+	0	ID=BBa_R2000;Name=BBa_R2000
BBa_Q20050	.	sequence_feature	434	442	.	+	0	ID=annotation318100;Name=consensus;Parent=BBa_R2000
BBa_Q20050	.	promoter	443	448	.	+	0	ID=annotation318094;Name=-35;Parent=BBa_R2000
BBa_Q20050	.	promoter	466	471	.	+	0	ID=annotation318098;Name=-10;Parent=BBa_R2000
BBa_Q20050	.	start_codon	478	478	.	+	0	ID=annotation318102;Name=(+1);Parent=BBa_R2000
BBa_Q20050	.	non_covalent_binding_site	453	466	.	+	0	ID=annotation318099;Name=Zif23;Parent=BBa_R2000
BBa_Q20050	.	CDS	22	288	.	+	0	ID=BBa_C2005;Name=BBa_C2005
BBa_Q20050	.	start_codon	22	24	.	+	0	ID=annotation1903904;Name=start codon;Parent=BBa_C2005
BBa_Q20050	.	non_covalent_binding_site	187	282	.	+	0	ID=annotation1903906;Name=GCN4 leucine zipper homodimerization domain;Parent=BBa_C2005
BBa_Q20050	.	CDS	22	288	.	+	0	ID=annotation1903901;Name=Zif268.GCN4;Parent=BBa_C2005
BBa_Q20050	.	sequence_feature	172	186	.	+	0	ID=annotation1903905;Name=domain linker;Parent=BBa_C2005
BBa_Q20050	.	non_covalent_binding_site	25	111	.	+	0	ID=annotation1903902;Name=finger 2 of Zif268;Parent=BBa_C2005
BBa_Q20050	.	stop_codon	283	288	.	+	0	ID=annotation1903907;Name=double stop codon;Parent=BBa_C2005
BBa_Q20050	.	non_covalent_binding_site	112	171	.	+	0	ID=annotation1903903;Name=finger 3 of Zif268;Parent=BBa_C2005
>BBa_Q20050
attaaagaggagaaatactagatgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctga
ccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacga
acgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccac
ctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataatactagagccaggcatcaaataaaacga
aaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct
caccttcgggtgggcctttctgcgtttatatactagagagtttattcttgacatggtcccacgcgcgtgggatactacg
tcag