BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_Q200514 1 BBa_Q200514 Dimeric zinc finger based inverter 2007-03-27T11:00:00Z 2015-05-08T01:14:14Z To be entered. To be entered. false false _41_ 0 126 70 It's complicated false To be entered. false Reshma Shetty component1922881 1 BBa_B0012 component1922878 1 BBa_C2005 component1922889 1 BBa_R2114 component1922869 1 BBa_B0030 component1922879 1 BBa_B0010 annotation1922878 1 BBa_C2005 range1922878 1 22 288 annotation1922881 1 BBa_B0012 range1922881 1 385 425 annotation1922879 1 BBa_B0010 range1922879 1 297 376 annotation1922889 1 BBa_R2114 range1922889 1 434 505 annotation1922869 1 BBa_B0030 range1922869 1 1 15 BBa_R2114 1 BBa_R2114 Promoter with operator site for C2003 2006-10-22T11:00:00Z 2015-05-08T01:14:16Z This part was inadvertently made while trying to make BBa_R2111. It contains a single base pair mutation in the -10 site of BBa_R2111. This promoter is designed to bind to C2003. false false _41_ 0 126 70 It's complicated false The placement of the operator site was designed to be near optimal for steric interference between C2003 and RNA polymerase. false Reshma Shetty annotation1904659 1 -10 site range1904659 1 40 45 annotation1904661 1 transcription start site range1904661 1 53 53 annotation1904660 1 -35 site range1904660 1 17 22 annotation1904662 1 C2003 operator site range1904662 1 23 34 BBa_C2005 1 BBa_C2005 Homodimeric zinc finger 2006-10-20T11:00:00Z 2015-08-31T04:07:25Z This part is derived from BBa_C2002. This is protein based on Scot Wolfe's Zif268-GCN4 homodimeric zinc finger protein. It is a fusion of fingers 2 and 3 of Zif268 (mouse) and the leucine zipper domain of GCN4 (yeast). false false _41_ 0 126 70 Not in stock false This protein contains no tags (like an LVA tag or His tag). false Reshma Shetty annotation1903904 1 start codon range1903904 1 1 3 annotation1903903 1 finger 3 of Zif268 range1903903 1 91 150 annotation1903907 1 double stop codon range1903907 1 262 267 annotation1903905 1 domain linker range1903905 1 151 165 annotation1903906 1 GCN4 leucine zipper homodimerization domain range1903906 1 166 261 annotation1903901 1 Zif268.GCN4 range1903901 1 1 267 annotation1903902 1 finger 2 of Zif268 range1903902 1 4 90 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R2114_sequence 1 tttatcaaaaagagtgttgactcccacgcgtgggaataggatatttagattcataaatttgagagaggagtt BBa_B0030_sequence 1 attaaagaggagaaa BBa_C2005_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_Q200514_sequence 1 attaaagaggagaaatactagatgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtttatcaaaaagagtgttgactcccacgcgtgggaataggatatttagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z