BBa_R00100 1 BBa_R00100 Tet promoter and sRBS 2005-03-08T12:00:00Z 2015-05-08T01:14:14Z Used as an intermediate construct for a specialized ribosome reporter false false _11_6_ 0 135 7 Not in stock false false Barry Canton component1435314 1 BBa_R0040 component1435319 1 BBa_B0036 annotation1435319 1 BBa_B0036 range1435319 1 63 67 annotation1435314 1 BBa_R0040 range1435314 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0036 1 BBa_B0036 Specialized RBS 2004-06-07T11:00:00Z 2015-08-31T04:07:20Z Brink MF, Verbeet MP, de Boer HA (1995). Specialized ribosomes: highly specific translation in vivo of a single targetted mRNA species. Gene, 156, pp. 215-222 This RBS is recognized by ribosomes carrying the modified anti-Shine Dalgarno sequence as found in Brink et al. (see below) false false _11_6_ 0 135 7 Not in stock false false Barry Canton BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0036_sequence 1 gtgtg BBa_R00100_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z