BBa_R0053 1 cII p22 Promoter (p22 cII regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage p22. Released HQ 2013 The p22 cII regulatory region sequence is a 97 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. p22 cII repressor protein, BBa_C0053, binds to it.<br> This segment contains O-R1, O-R2, a fragment of O-R3, the -35 of P-RM, and P-R (-10 and -35 from Tom Knight)</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2041 1 -35 range2041 1 8 13 annotation2035 1 OR3 range2035 1 1 3 annotation7069 1 BBa_R0053 range7069 1 1 54 annotation2042 1 -10 range2042 1 30 35 annotation2038 1 -35 range2038 1 18 23 annotation2037 1 OR1 range2037 1 34 51 annotation2036 1 OR2 range2036 1 11 28 BBa_R0053_sequence 1 aataaacttgactaaagattcctttagtagataatttaagtgttctttaatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z