BBa_R0061 1 luxR Promoter (HSL-mediated luxR repressor) 2004-01-28T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 This part involves the -10 binding site, the -35 binding site, and the twenty nucleotides between that constitute the lux box. With this part, LuxR functions as a acyl-homoserine lactone-dependent repressor. LuxR resonds to the HSL produced by LuxI, N-(3-oxohexanoyl)-HSL. The Lux box is positioned such that it partially overlaps the consensus -35 and -10 hexamers of an RNA polymerase binding site. false true _1_ 0 24 7 In stock false true Srini Devadas, David Gray, Ronny Krashinsky, Debra Lin, and Chris Zheng Liu annotation305863 1 -35 range305863 1 1 6 annotation305877 1 Lux Box range305877 1 6 25 annotation305864 1 -10 range305864 1 25 30 BBa_R0061_sequence 1 ttgacacctgtaggatcgtacaggtataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z