BBa_R0077 1 cinR Promoter (cinR and HSL regulated, RBS+) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 CinR (BBa_C0077) in complex with O3-C14:1-HSL (from CinI, BBa_C0076) binds to this promoter and activates transcription. This promoter contains the RBS: TGGAGG false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 Change log: the last 5 bases (gctaa) removed to allow for the correct spacing between the RBS (TGGAGG) and the start of the downstream gene after biobricks splicing. true crackdots annotation301205 1 stem_loop range301205 1 91 136 annotation301371 1 unidentified/uncharacterized CinR dependent range301371 1 1 220 annotation301204 1 stem_loop range301204 1 35 74 annotation301150 1 embedded RBS range301150 1 226 231 BBa_R0077_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z