BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331786 1 stem_loop range331786 1 22 37 annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z