BBa_R0085 1 BBa_R0085 T7 Consensus Promoter Sequence 2005-02-21T12:00:00Z 2015-05-08T01:14:15Z Sequence obtained from Sri Kosuri Released HQ 2013 The T7 promoter should only produce PoPS when the T7 polymerase is also being expressed. false false _11_6_ 0 135 7 In stock false false Barry Canton annotation1721522 1 Initiation Region range1721522 1 12 23 annotation1721521 1 Polymerase Binding Region range1721521 1 1 11 annotation1721520 1 Transcription Start Site range1721520 1 18 18 BBa_R0085_sequence 1 taatacgactcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z