BBa_R0187 1 BBa_R0187 T7 promoter (lacI repressible) 2008-04-07T11:00:00Z 2015-05-08T01:14:15Z This sequence is based on the T7lac promoter described by Dubendorff and Studier (JMB 1991, 219, 45-59). The only modification is the mutation at -9. A lac repressible T7 promoter. This promoter is similar to those found in the pET vectors with T7lac promoters. I mutated the -9 base to an G, which should make it less than 3% of the strength of consensus. The base numbering is as used by Studier and coworkers (JMB 1991, 219, 45-59). See BBa_R0183 for more information. false false _11_ 0 135 84 Not in stock false The -9 mutation from consensus was included to weaken the consensus promoter as described by Imburgio and co-workers (see BBa_R0183 for more information) false Bartholomew Canton annotation1962097 1 T7 promoter range1962097 1 1 20 annotation1962096 1 LacI binding site range1962096 1 20 44 BBa_R0187_sequence 1 taatacgagtcactataggggaattgtgagcggataacaattcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z