BBa_R1052 1 cI 434 Promoter, Standard (434 cI regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Bacteriophage 434 right operator [Note: This is the same part as R0052 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 It's complicated false <P> <P>Wild-type promoter modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> false Maia Mahoney, Drew Endy annotation2082 1 -35 range2082 1 1 6 annotation2083 1 -35 range2083 1 2 7 annotation2080 1 OR2 range2080 1 8 21 annotation2081 1 OR1 range2081 1 30 43 annotation2087 1 -10 range2087 1 24 29 annotation2084 1 start range2084 1 35 37 annotation2079 1 -10 range2079 1 1 43 annotation7075 1 BBa_R1052 range7075 1 1 46 BBa_R1052_sequence 1 ttgacaaacaagatacattgtatgatactacaagaaagtttgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z