BBa_R1053 1 cII p22 Promoter, Standard (p22 cII regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Bacteriophage p22. [Note: This is the same part as R0053 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The p22 cII regulatory region sequence is a 97 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. p22 cII repressor protein, BBa_C0053, binds to it.<br> This segment contains O-R1, O-R2, a fragment of O-R3, the -35 of P-RM, and P-R (-10 and -35 from Tom Knight)</p> false false _1_ 0 24 7 It's complicated false <P> <P>Modified from wild-type to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> false Maia Mahoney, Drew Endy annotation2090 1 OR1 range2090 1 35 52 annotation2094 1 -35 range2094 1 8 14 annotation2089 1 OR2 range2089 1 11 29 annotation2095 1 -10 range2095 1 31 36 annotation2091 1 -35 range2091 1 19 24 annotation2088 1 OR3 range2088 1 1 3 annotation7076 1 BBa_R1053 range7076 1 1 55 BBa_R1053_sequence 1 aataaacttgacataaagattcctttagtagatactttaagtgttctttaatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z