BBa_R1062 1 lux pR Promoter, Standard (luxR and HSL regulated -- lux pR)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 [Note: This is the same part as R0062 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].</p> <p>Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false false _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file part=BBa_R0062>Image1.gif</bb_file>" width="614" height="362"><br><br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br> <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr<br> Drew Endy<br> annotation2100 1 start range2100 1 54 54 annotation7077 1 BBa_R1062 range7077 1 1 56 annotation2099 1 -10 range2099 1 42 48 annotation2101 1 -35 range2101 1 20 25 annotation2098 1 LuxR/HSL range2098 1 1 20 BBa_R1062_sequence 1 acctgtaggatcgtacaggttgacacaagaaaatggtttgttgatactcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z