BBa_R2108 1 BBa_R2108 Promoter with operator site for C2003 2006-10-20T11:00:00Z 2015-05-08T01:14:16Z This promoter was rationally designed. This promoter is designed to bind to C2003. false false _41_ 0 126 70 Not in stock false Placement of the operator sites was optimized for steric interference between the C2003 and RNA polymerase based on structural models. false Reshma Shetty annotation1903911 1 transcription start site range1903911 1 53 53 annotation1903908 1 -35 site range1903908 1 17 22 annotation1903909 1 operator site for C2003 range1903909 1 32 43 annotation1903910 1 -10 site range1903910 1 40 45 BBa_R2108_sequence 1 tttatcaaaaagagtgttgacatttttaagtcccacgcgtgggattagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z