BBa_R2109 1 BBa_R2109 Promoter with operator site for C2003 2006-10-20T11:00:00Z 2015-05-08T01:14:16Z This promoter was rationally designed and synthesized. Released HQ 2013 This promoter is designed to bind to C2003. false false _41_ 0 126 70 In stock false Placement of the operator site was determined to optimize steric interference between C2003 and RNA polymerase. false Reshma Shetty annotation1903913 1 -10 site range1903913 1 40 45 annotation1903914 1 transcription start site range1903914 1 53 53 annotation1903915 1 operator site for C2003 range1903915 1 22 33 annotation1903912 1 -35 site range1903912 1 17 22 BBa_R2109_sequence 1 tttatcaaaaagagtgttgatcccacgcgtgggatataggatacttagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z