BBa_R2111 1 BBa_R2111 Promoter with operator site for C2003 2006-10-20T11:00:00Z 2015-05-08T01:14:16Z This promoter was rationally designed. This promoter is designed to bind to C2003. false false _41_ 0 126 70 Not in stock false The placement of the operator was designed to be near optimal for steric interference between C2003 and RNA polymerase. false Reshma Shetty annotation1903921 1 -10 site range1903921 1 40 45 annotation1903923 1 C2003 operator site range1903923 1 23 34 annotation1903922 1 transcription start site range1903922 1 53 53 annotation1903920 1 -35 site range1903920 1 17 22 BBa_R2111_sequence 1 tttatcaaaaagagtgttgactcccacgcgtgggaataggatacttagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z