BBa_R2113 1 BBa_R2113 Promoter with operator site for C2003 2006-10-20T11:00:00Z 2015-05-08T01:14:16Z This promoter was designed rationally. This promoter is designed to bind to C2003. false false _41_ 0 126 70 Not in stock false The placement of the operator site was designed to be near optimal for steric interference between C2003 and RNA polymerase. false Reshma Shetty annotation1904658 1 C2003 operator site range1904658 1 21 32 annotation1904657 1 transcription start site range1904657 1 53 53 annotation1904655 1 -35 site range1904655 1 17 22 annotation1904656 1 -10 site range1904656 1 40 45 BBa_R2113_sequence 1 tttatcaaaaagagtgttgtcccacgcgtgggactataggatacttagattcataaatttgagagaggagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z